View Full Version : The 100% Happy Wheels Discussion Station
SupSuper
19 Sep 2008, 19:50
Fine, next time I'll just say "math sucks" and be done with it.
AndrewTaylor
19 Sep 2008, 23:17
Actually, the largest number is about 45 billion.
philby4000
20 Sep 2008, 01:59
I'm going to go ahead and ask why the numbers that are more than that don't count.:(
Akuryou13
20 Sep 2008, 03:49
Find two and you can use them for data encryption.
The point is rarely as clear as it seems. Many major discoveries in maths and science -- maybe even most of them -- are made by accident. But you have to research something to find anything. As long as 'blue-sky' research is done, it will turn up useful and interesting results periodically.
Finding large primes is probably more use as a tool for other researchers than anything else.I guess that makes sense.
Paul.Power
20 Sep 2008, 19:37
delicious. (http://forums.sonicretro.org/index.php?showtopic=12056)
Squirminator2k
20 Sep 2008, 20:10
You should see what's for pudding.
worMatty
20 Sep 2008, 23:28
That looks, sounds and plays much nicer than what I was expecting. I'm looking forward to it. I'll have to get a PC joypad!
GoDxWyvern
21 Sep 2008, 00:06
delicious. (http://forums.sonicretro.org/index.php?showtopic=12056)
Holy damn. I'm having a hard time trying not to wet myself on the spot. The visuals and audio are beyond brilliant, and the physics are almost perfectly recreated. I'm absolutely rapt away.
I'll spare myself the jumping around like a schoolgirl, though.
philby4000
21 Sep 2008, 02:21
You should see what's for pudding.
Sounds a little hard to swallow.
FutureWorm
21 Sep 2008, 06:53
delicious. (http://forums.sonicretro.org/index.php?showtopic=12056)
wow, i can't believe they actually have a semi-working release. perhaps this project will impress me yet.
brb, rebooting into windows
FutureWorm
21 Sep 2008, 07:07
holy crap this is awesome. of course, getting all the assets together for the whole game will still take another couple years, and i doubt that they'll be able to stick it out that long. however, my mind is rather blown at the moment.
Unfortunately, my laptop doesn't support the resolution it wants, my screen isn't big enough.
Oh well. It does look amazing though.
SupSuper
21 Sep 2008, 13:36
Well it definitely plays like Sonic, which is great.
I sure hope those requirements are purely a guess though, otherwise they're challenging Crysis.
GoDxWyvern
21 Sep 2008, 17:36
They have to be, all three versions work without framerate drops on my machine (P4 2.54 GHz, 1 GB RAM, 256 MB GeForce 6200).
Paul.Power
21 Sep 2008, 18:34
I think it was basically tested on one machine, and they decided to make that machine's numbers the rec specs because they didn't have the funds to test it on others.
Of course, I didn't actually try to run it before. It doesn't need full screen and works perfectly on my laptop!
Hooray! My laptop isn't the worst laptop for gaming ever!
SupSuper
23 Sep 2008, 22:39
So how about that The Sims movie... (http://www.collider.com/entertainment/interviews/article.asp/aid/9244/tcid/1)
FutureWorm
24 Sep 2008, 02:13
So how about that The Sims movie... (http://www.collider.com/entertainment/interviews/article.asp/aid/9244/tcid/1)
can't say i'd heard about it, but after reading the pitch it sounds really ****ing stupid
Akuryou13
24 Sep 2008, 08:16
So how about that The Sims movie... (http://www.collider.com/entertainment/interviews/article.asp/aid/9244/tcid/1)oh my god that sounds generic and horrible!
AndrewTaylor
24 Sep 2008, 23:09
Yeah. I went there.
Squirminator2k
24 Sep 2008, 23:16
You forgot to add "War Hero and Former POW" to the beginning of the thread title.
AndrewTaylor
24 Sep 2008, 23:18
Former POW
I think it's fair to say he's still a prisoner of war.
That, or he has that Stockholm syndrome -- he was a prisoner of war for so long that he fell in love with it.
Squirminator2k
24 Sep 2008, 23:25
Bender's "demonstration" of Stockholm syndrome is brilliant.
But that's off-topic.
FutureWorm
25 Sep 2008, 00:58
awesome thread title
SomePerson
25 Sep 2008, 04:58
I was about to say the same thing
FutureWorm
25 Sep 2008, 05:32
I was about to say the same thing
hey! are you registered to vote?
although you're in california so it's not like your vote counts, lol :-/
SomePerson
25 Sep 2008, 08:11
Hell yeah I'm registered. Voted for Obama in the primaries, and intend to do so again.
That is kinda funny though, how your vote counts more if you're in one of the so called swing states. Although I'm still voting if not at least just to say I voted for Obama, and because California would be a terrible loss should such a thing happen, and we don't want that.
thomasp
25 Sep 2008, 10:51
What's the point in voting in America? McCain's just going to rig the result so as he wins - like Bush did with Gore. And then McCain will pop his cloggs and Palin will be in charge and we'll all be even more doomed than we already are :p
FutureWorm
26 Sep 2008, 06:47
What's the point in voting in America? McCain's just going to rig the result so as he wins - like Bush did with Gore. And then McCain will pop his cloggs and Palin will be in charge and we'll all be even more doomed than we already are :p
i realize you're joking, but come on now, you're sounding like a stupid european
also, sp, my vote is worth at least three of yours :cool:
Paul.Power
26 Sep 2008, 09:35
We've had more sunshine in the last two weeks than we did in the whole of July and August.
Seriously, what the hell, weather?
GrimOswald
26 Sep 2008, 16:27
We've had more sunshine in the last two weeks than we did in the whole of July and August.
Seriously, what the hell, weather?
Man, do NOT get me started on weather. In New Zealand it goes from boiling to raining to snowing to humid to cloudy to cold to SQUIRRELS. All in the same day. Silly things like seasons are certainly nothing to judge by.
Squirminator2k
26 Sep 2008, 17:00
LA Weather = Sunny and Warm Forever.
I'm getting a bit irritated by it. I miss the rain. Dear Glod, I miss the rain.
Paul.Power
26 Sep 2008, 17:31
Man, do NOT get me started on weather. In New Zealand it goes from boiling to raining to snowing to humid to cloudy to cold to SQUIRRELS. All in the same day. Silly things like seasons are certainly nothing to judge by.I always think Captain Cook should have named New Zealand "New South Wales" instead of... well, New South Wales. Rain, mountains, sheep, rugby union... there's a connection here :p.
AndrewTaylor
26 Sep 2008, 19:48
That is kinda funny though, how your vote counts more if you're in one of the so called swing states.
That's almost fair enough... it's the fact that you win on number of states and it's not adjusted for population. Effectively, Connecticut is a rotten borough.
Paul.Power
26 Sep 2008, 20:29
That's almost fair enough... it's the fact that you win on number of states and it's not adjusted for population. Effectively, Connecticut is a rotten borough.
Well, it is adjusted for population... there's the whole electoral college thing where California gets 55 seats and Connecticut gets 7 and so on.
AndrewTaylor
26 Sep 2008, 20:37
Well, it is adjusted for population... there's the whole electoral college thing where California gets 55 seats and Connecticut gets 7 and so on.
Some bits are and some bits aren't. I forget which are which -- it doesn't matter since so many of the voters in all states are morons.
SomePerson
26 Sep 2008, 23:20
Senate has 2 seats per state, and the House depends on population. Electoral college combines the two, so that smaller states get slightly more representation than they deserve. Honestly, it seems that even in this country most people want to do away with the whole electoral college. You can theoretically win with a minimum of 26% of the vote if you barely get the states you win and if you lose the other states catastrophically.
FutureWorm
26 Sep 2008, 23:56
Some bits are and some bits aren't. I forget which are which -- it doesn't matter since so many of the voters in all states are morons.
cool, thanks
AndrewTaylor
27 Sep 2008, 00:55
cool, thanks
What? Wait until the election, see how many people vote McCain/Palin. That number, plus 100% - voter turnout, is the lower limit on the number of morons in the electorate. Does it much matter which morons you ask?
FutureWorm
27 Sep 2008, 01:07
What? Wait until the election, see how many people vote McCain/Palin. That number, plus 100% - voter turnout, is the lower limit on the number of morons in the electorate. Does it much matter which morons you ask?
it seems like your only thought on americans is that they are stupid hurr hurr which gets tedious after a while
AndrewTaylor
27 Sep 2008, 12:33
it seems like your only thought on americans is that they are stupid hurr hurr which gets tedious after a while
Tedious perhaps, but also important and demonstrably true.
I don't mean to sound like I'm stereotyping here, but by now only someone whose brain is not properly functioning could support McCain. He constantly lies, even where the truth would have worked just as well, he reads books and then relates the tales as if they happened to him, he's a 72 year old man with a 4000-page medical record which he refuses to release despite having chosen the single least qualified VP selection in history, he votes with Bush all the time except when he doesn't bother to turn up which was about one in three times before he started campaigning and is now every single time since April, except last week when he went to vote on the bailout, which he claimed was because he was needed despite having repeatedly admitted he doesn't understand the economy, and was in fact a rather stupid attempt to escape a debate (which he's running ads saying he won -- ads which went live before the debate started), he has the lightest workload of any candidate in memory and admits he's 'not sharp' if he has to get up early, his VP is a Creationist who thinks she has foreign policy experience because Alaska is near to two other countries and there are video clips of her in church denouncing witchcraft and supporting an organisation whose aim is to get Alaska out of the USA. Oh, and I think there was something about a bridge.
Edit: ... and literally since I wrote this message, because the runaway mine-cart that is the McCain campaign just never stops acting stupid, I have found out that he's running an advert attacking Obama for sometimes agreeing with him (http://www.youtube.com/watch?v=Ec3aC8ZJZTc).
According to Gallup, Obama leads 48% to 45%. That means that at least 52% of the electorate are morons. This election will directly affect me but my opinion is not considered and the issue is being decided by a dumb system in a country slightly more than half of whom are idiots. This concerns me and I think it's important enough to bear mentioning a couple more times.
Any questions?
I wonder how many people in FanArt think I've gone completely insane now from watching static. :D
It seems plausible that someone might start hallucinating after going through over 800 channels of static.,
worMatty
27 Sep 2008, 23:34
Stuff
Holy ****. What he said!
Where do you get your info., Andrew? You look like you have a good grasp of US political goings-on.
SomePerson
27 Sep 2008, 23:44
he's running an advert attacking Obama for sometimes agreeing with him (http://www.youtube.com/watch?v=Ec3aC8ZJZTc).
HAHAHAHA that advert is amazing. I'm in shock - that can't possibly be real, can it?.........Oh dear...
AndrewTaylor
27 Sep 2008, 23:52
Holy ****. What he said!
Where do you get your info., Andrew? You look like you have a good grasp of US political goings-on.
I get a lot of it from the Jed Report. McCain is just hours of fun.
McCain has a nice lump on his cheek.
There's just something about how he talks that creeps me out. He reminds me a bit of both Bush and Montgomery Burns.
thomasp
28 Sep 2008, 09:11
Well... The Simpsons do always portray Burns as the leader of the Republican party, so I can kind of see where you're coming from. All McCain needs is a long pointed nose and that'd be that!
He definitely has the bad health of Burns.
All he'd need was the Finger Pyramid of Evil Contemplation. :D
http://a414.ac-images.myspacecdn.com/images01/76/s_96697f36353d91623c8c9b75bb0cc1c5.png
SupSuper
29 Sep 2008, 23:34
Nintendo can be incredibly clever sometimes (http://www.youtube.com/experiencewii)
FutureWorm
29 Sep 2008, 23:52
Nintendo can be incredibly clever sometimes (http://www.youtube.com/experiencewii)
that is absurdly cool. i can't imagine how long it took to code
AndrewTaylor
29 Sep 2008, 23:53
That's brilliant.
Squirminator2k
30 Sep 2008, 00:17
I'm in love with Nintendo.
Akuryou13
30 Sep 2008, 04:22
that was possibly the neatest thing I've seen in a long time!
I was totally not expecting that! Amazing!
but by now only someone whose brain is not properly functioning could support McCain.
I disagree. It's not a one-off thing for politicians to lie or make promises that they can't keep. It makes more sense to vote based on your political alignment rather than dwell on the flaws of the particular candidate. Surely having your country go in a direction you don't want it to is much worse than having your president ridiculed in the media?
That Nintendo thing was awesome!
But more importantly, I feel that the pizza discussion needs to be revived. Today I had the opportunity to photograph the baddest pizza we got.
http://img145.imageshack.us/img145/6201/cimg1201gz6.th.jpg (http://img145.imageshack.us/my.php?image=cimg1201gz6.jpg)http://img145.imageshack.us/images/thpix.gif (http://g.imageshack.us/thpix.php)
It's quite healthy :)
FutureWorm
30 Sep 2008, 22:36
That Nintendo thing was awesome!
But more importantly, I feel that the pizza discussion needs to be revived. Today I had the opportunity to photograph the baddest pizza we got.
http://img145.imageshack.us/img145/6201/cimg1201gz6.th.jpg (http://img145.imageshack.us/my.php?image=cimg1201gz6.jpg)http://img145.imageshack.us/images/thpix.gif (http://g.imageshack.us/thpix.php)
It's quite healthy :)
i get physically nauseous looking at that
Akuryou13
30 Sep 2008, 23:40
That Nintendo thing was awesome!
But more importantly, I feel that the pizza discussion needs to be revived. Today I had the opportunity to photograph the baddest pizza we got.
http://img145.imageshack.us/img145/6201/cimg1201gz6.th.jpg (http://img145.imageshack.us/my.php?image=cimg1201gz6.jpg)http://img145.imageshack.us/images/thpix.gif (http://g.imageshack.us/thpix.php)
It's quite healthy :)that isn't pizza. that's some sort of mutant food-impersonating alien disease.
Pickleworm
1 Oct 2008, 02:08
i get physically nauseous looking at that
I was pretty much going to post this verbatim
that isn't pizza. that's some sort of mutant food-impersonating alien disease.
Hah, I knew it!. Well, at least they are not all like that. =P
The next time you are hungry just look at that picture and you will be cured and good to go for at least a hour!
worMatty
1 Oct 2008, 19:52
Wow, that looks nice.
AndrewTaylor
1 Oct 2008, 19:57
I disagree. It's not a one-off thing for politicians to lie or make promises that they can't keep. It makes more sense to vote based on your political alignment rather than dwell on the flaws of the particular candidate. Surely having your country go in a direction you don't want it to is much worse than having your president ridiculed in the media?
You say that, but it's a false dilemma. You can pack Congress with Republicans and still have Barack Obama be the one with his calm, rational, well-informed finger on the nuclear button. Besides which, these things come in shades of grey. It's not really the case that conservatives have a choice between being incompetently led forwards or competently led backwards. In most respects Obama wants the same things as McCain: a strong economy, security, low crime, etc. People focus on the differences for obvious reasons, but honestly, a moron on your side will do more damage to your dreams than a smart man you disagree with about the best way to get things done. And there's always the danger that a 75 year old man in a stressful job might die, at which point you have a choice between a smart man you disagree with and a fundamentalist nutcase with less political experience than Weebl and Bob.
In any case, 'his direction' is the same one that over the last seven years has ****ed up the economy, started two wars, tried to 'debunk' climate change, suspended the Geneva Convention and passed laws requiring creationism be taught in schools. I don't see how anyone can support that either.
But mostly, I just don't accept that the fact that other politicians are bad too makes it not matter: the only politician that is credibly running against McCain is Barack Obama, and I think that you will find it very difficult to unearth evidence of him lying or making the kind of phenomenally dumb gaffe that McCain makes every other day.
Reading the "Current Activity" on my profile page, I can see that I'm browsing the OD forum and threads within OD.
Has that been that way before for OD members?
Or has something been changed by accident since the VB update and now everyone can see me browsing secret forums?
I can also see volcadmin browsing the Admin Control Panel. Can't remember that from before. :-/
Edit:
When logged out, as a guest, I can see volcadmin on the Admin Control Panel.
Edit 2:
Nevermind.
Someone browsing OD shows up as "Viewing Thread" only for a guest, so I suppose it's the same for non-OD members.
Reading the "Current Activity" on my profile page, I can see that I'm browsing the OD forum and threads within OD.
Has that been that way before for OD members?
Yup
Or has something been changed by accident since the VB update and now everyone can see me browsing secret forums?
Don't think so. It shouldn't do, since we use a standard vB way of restricting access to OD.
I can also see volcadmin browsing the Admin Control Panel. Can't remember that from before. :-/
Yup, always been there. And you might see random moderation-related things with me & andrew.
Edit 2:
Nevermind.
Someone browsing OD shows up as "Viewing Thread" only for a guest, so I suppose it's the same for non-OD members.
Yes, it is. That occasionally comes up in OD leak threads that people are just viewing a generic thread rather than a specific one.
bonz, I'm way ahead of you, I looked at that as soon as I saw it was upgraded. I suppose there is the offchance that in the future someone will look at that and wonder why it doesn't specify a thread... maybe someone could hack it to display "viewing forum index" for non-ODers.
Pigbuster
4 Oct 2008, 02:53
Korean comedian does Starcraft unit impersonations.
http://www.youtube.com/watch?v=rx4sOAt2EPM
:D
SupSuper
4 Oct 2008, 03:06
As someone who keeps driving random IRC channels into Starcraft quoting wars, that is pretty damn awesome.
Although it still surprises me how he doesn't have to worry about people "not getting it" in Korea. :p
philby4000
5 Oct 2008, 19:25
So 'the Core' was on channel 4 last night.
I never realized lightning was so explosive.
Alien King
5 Oct 2008, 19:31
I never realized lightning was so explosive.
That film proves just how little I know about things like 'Science'.
:rolleyes:
AndrewTaylor
5 Oct 2008, 23:19
So 'the Core' was on channel 4 last night.
I never realized lightning was so explosive.
It is the greatest film ever made. I love that they even threw in a bunch of errors that didn't affect the plot at all -- just in case we thought they knew that the science was wrong but prioritised drama over realism. Nope, they're just dullards.
It was basically Armageddon going backwards, if memory serves.
SupSuper
6 Oct 2008, 13:57
And yet the writer (http://www.aintitcool.com/display.cgi?id=14288) thinks it's pretty sound.
Paul.Power
6 Oct 2008, 17:31
The trouble with that writer is that he's taking apart something of a strawman argument.
Now this... (http://intuitor.com/moviephysics/core.html)
(He's also complaining that people don't tear apart other movies with the same enthusiasm. Not a valid complaint as, well, the site I got that review from does, for one. (http://intuitor.com/moviephysics/)).
AndrewTaylor
6 Oct 2008, 18:26
And yet the writer (http://www.aintitcool.com/display.cgi?id=14288) thinks it's pretty sound.
The DVD commentary is great -- he points out a couple of other errors I hadn't spotted. But come on, there's a needless science error in the first two minutes, a punctuation error in the last two, a spelling error in the 'destini'/'destiny' caption, and he thinks one is a prime number.
I admire that he tried. But he failed.
Randomly came across this on YouTube earlier - part of the latest Simpsons Treehouse of Horrors episode to be screened in the USA on November 2nd '08. It seems the Simpsons producers are quite anti-republican...
http://www.youtube.com/watch?v=1aBaX9GPSaQ&feature=bz301
Randomly came across this on YouTube earlier - part of the latest Simpsons Treehouse of Horrors episode to be screened in the USA on November 2nd '08. It seems the Simpsons producers are quite anti-republican...
http://www.youtube.com/watch?v=1aBaX9GPSaQ&feature=bz301
I have read that the McCain campaign team isn't pleased that this episode will be aired on November 2nd, two days before the election.
Squirminator2k
7 Oct 2008, 16:01
This is because they think it might sway that guy who's going to vote for them into not voting for them.
All that clip says to me is that the USA's election process bears many similarities with that of Zimbabwe's. A nice "free" and "fair" election in other words :p
SupSuper
7 Oct 2008, 19:54
So I found this: http://www.filehippo.com/updatechecker
If you've got an incessant need to keep your software up to date like me, it's very handy.
AndrewTaylor
8 Oct 2008, 01:01
If anyone wants a full list of thread titles, it's easily done, but it's very, very long. (About 175 excluding typos.)
Akuryou13
8 Oct 2008, 01:09
HAHA! I love the new one :D
Squirminator2k
8 Oct 2008, 02:21
Yes .
All 183 thread topic title changes. Note that each entry is not what it changed to but what it changed from. I'm sure you'll figure it out :p
18:57, 16th Apr 2006 AndrewTaylor Thread title (original 'The 100% OFF TOPIC Thread!') changed
17:54, 17th Apr 2006 thomasp Thread title (original 'The "reply to the post of the person above you" thread') changed
17:55, 17th Apr 2006 thomasp Thread title (original 'The "reply to the post of the person above you" thread / 100%OT') changed
22:39, 29th Apr 2006 thomasp Thread title (original 'The "reply to the post of the person above you" thread or just be 100% Off Topic') changed
22:40, 29th Apr 2006 thomasp Thread title (original 'The 99.99% Off-Topic thread') changed
22:36, 12th May 2006 AndrewTaylor Thread title (original 'The 99.9% Off-Topic thread') changed
21:13, 3rd Jun 2006 AndrewTaylor Thread title (original 'The 100% Off-Topic Deckchair') changed
16:49, 3rd Jul 2006 AndrewTaylor Thread title (original 'The 100% Off-Topic Marshmallow') changed
11:29, 5th Aug 2006 AndrewTaylor Thread title (original 'The 100% Off-Topic Hootenanny') changed
00:42, 6th Aug 2006 AndrewTaylor Thread title (original 'The 100% Off-Topic Shindig') changed
21:00, 22nd Aug 2006 AndrewTaylor Thread title (original 'The 100% Off-Topic Time Vortex') changed
19:02, 8th Sep 2006 AndrewTaylor Thread title (original '100% Off-Topic Events & Occurences') changed
17:07, 24th Sep 2006 thomasp Thread title (original 'The 100% Off-Topic... Er... Topic.') changed
15:05, 3rd Nov 2006 AndrewTaylor Thread title (original 'The 0% On-Topic... Er... Topic.') changed
10:49, 4th Dec 2006 AndrewTaylor Thread title (original 'The G100% Off-Topic Summit') changed
22:46, 12th Dec 2006 AndrewTaylor Thread title (original 'The Polonium-100% Off Topic Poisoning') changed
23:03, 26th Dec 2006 AndrewTaylor Thread title (original 'The London 100% Off Topic Olympics') changed
14:59, 31st Dec 2006 AndrewTaylor Thread title (original 'The 100% Off-Topic Days Of Christmas') changed
14:32, 1st Jan 2007 AndrewTaylor Thread title (original 'Jools Holland's 100% Off-Topic Hootenanny') changed
17:36, 13th Jan 2007 AndrewTaylor Thread title (original 'The 100% Off-Topic Honours List') changed
17:36, 13th Jan 2007 AndrewTaylor Thread title (original 'The January 100% Off-Topic Sales') changed
12:00, 15th Jan 2007 AndrewTaylor Thread title (original 'The January 100% Off-Topic Sale') changed
16:28, 16th Jan 2007 AndrewTaylor Thread title (original 'What are you posting... (T100%OTT)') changed
01:28, 17th Feb 2007 AndrewTaylor Thread title (original 'What you are posting... (T100%OTT)') changed
01:29, 17th Feb 2007 AndrewTaylor Thread title (original 'The Hecto-Percentile') changed
23:09, 2nd Mar 2007 AndrewTaylor Thread title (original 'The Hecto-Percentile Irrelevant Thread') changed
23:10, 2nd Mar 2007 AndrewTaylor Thread title (original 'Avogadro's') changed
15:29, 17th Mar 2007 AndrewTaylor Thread title (original 'Avogadro's 6.0221415 × 10^23% Off Topic Thread') changed
21:51, 18th Mar 2007 thomasp Thread title (original 'The 100% Off-Topic Forum Comic') changed
21:51, 18th Mar 2007 thomasp Thread title (original 'The 100% Being Watched for going off topic status') changed
19:39, 21st Mar 2007 thomasp Thread title (original 'The 100% Being Watched for going off topic...thing') changed
13:40, 27th Mar 2007 AndrewTaylor Thread title (original 'The 100% Offtopic Lawsuit') changed
13:18, 1st Apr 2007 AndrewTaylor Thread title (original 'The 100% Offtopic Avatar Fad') changed
11:55, 6th Apr 2007 thomasp Thread title (original 'The 100% Offtopic April Fools' Prank') changed
14:23, 11th Apr 2007 AndrewTaylor Thread title (original 'The 100% Offtopic Easter Egg Hunt') changed
23:27, 13th Apr 2007 AndrewTaylor Thread title (original 'The 100% Offtopic Voting Thread') changed
15:59, 18th Apr 2007 AndrewTaylor Thread title (original 'The 100% Offtopic Unofficial "Skins" House Party') changed
15:33, 20th Apr 2007 AndrewTaylor Thread title (original 'The 100% Offtopic Lovely Sunny Day') changed
01:04, 28th Apr 2007 AndrewTaylor Thread title (original 'Google 100% Offtopic Search (Beta)') changed
19:22, 2nd May 2007 AndrewTaylor Thread title (original 'The 404% Topic Not Found Error') changed
11:45, 5th May 2007 AndrewTaylor Thread title (original 'The $200% Off-Topic Thread') changed
10:17, 6th May 2007 AndrewTaylor Thread title (original 'The Ageless, Faceless, Gender Neutral, Culturally Ambiguous 100% Off-Topic Thread') changed
12:03, 9th May 2007 AndrewTaylor Thread title (original 'Looks Like I Hit The 100% Off-Topic Thread, Jim') changed
16:21, 10th May 2007 AndrewTaylor Thread title (original 'Somebody Set Up Us The 100% Off-Topic Thread') changed
23:43, 16th May 2007 AndrewTaylor Thread title (original '100% Off-Topic Fred') changed
15:06, 18th May 2007 AndrewTaylor Thread title (original 'Organic Thread: 100% Topic Free') changed
10:49, 20th May 2007 thomasp Thread title (original 'The Homeopathic 0.001% Off-Topic Thread') changed
12:23, 22nd May 2007 AndrewTaylor Thread title (original 'The 100% Carbon neutral tree-hugging off-topic thread') changed
23:05, 23rd May 2007 AndrewTaylor Thread title (original 'The Highly Scientific (98.2 ± 4.6)% Off Topic Thread') changed
13:21, 25th May 2007 AndrewTaylor Thread title (original 'The 99.999...% (But Certainly Not 100%) Off-Topic Thread') changed
13:21, 25th May 2007 AndrewTaylor Thread title (original 'The 100% Off-Topic PIRATES') changed
12:11, 31st May 2007 AndrewTaylor Thread title (original 'The 100% Off-SONIC Thread') changed
00:45, 2nd Jun 2007 AndrewTaylor Thread title (original 'The 100% AUGCAAUUCUUUACUCAGCCUAUUUGUUAG mRNA (apparently)') changed
09:02, 3rd Jun 2007 AndrewTaylor Thread title (original 'The 100% Ineffable Divine Thread') changed
23:42, 3rd Jun 2007 thomasp Thread title (original 'The 100%, Off-Topic Thread') changed
20:14, 4th Jun 2007 AndrewTaylor Thread title (original 'The 100%, Off-Thread Topic') changed
08:37, 7th Jun 2007 thomasp Thread title (original 'Russell's 100% Off-Topic Teapot') changed
08:38, 7th Jun 2007 thomasp Thread title (original 'Ikea 100% Flatpack self assembly topic') changed
20:32, 15th Jun 2007 AndrewTaylor Thread title (original 'Ikea 100% Flatpack self assembly samtalsämne') changed
15:52, 1st Jul 2007 AndrewTaylor Thread title (original 'The 100% Awesome Thread And I Can't Stop Laughing') changed
11:34, 14th Jul 2007 AndrewTaylor Thread title (original 'Probably The Most 100% Off-Topic Thread In The World') changed
19:37, 27th Jul 2007 AndrewTaylor Thread title (original 'The x100% Off-Topic Combo') changed
11:04, 8th Aug 2007 AndrewTaylor Thread title (original 'The 4%, 8%, 15%, 16%, 23%, 42% Off Topic Thread') changed
23:51, 8th Aug 2007 AndrewTaylor Thread title (original 'The 100% Off Topic Thread: Now Featuring 50% Less Laugh At The Stupid People') changed
23:51, 8th Aug 2007 AndrewTaylor Thread title (original 'can a mod please lock this thread?') changed
16:49, 15th Aug 2007 AndrewTaylor Thread title (original 'can a mod please lock this 100% off topic thread?') changed
23:33, 18th Aug 2007 AndrewTaylor Thread title (original 'The 1000‰ Off-Topic Thread') changed
23:39, 25th Aug 2007 AndrewTaylor Thread title (original 'The X Percent Off-Topic Factor') changed
20:06, 28th Aug 2007 AndrewTaylor Thread title (original 'The 42% Off Topic Guide To The Galaxy') changed
10:42, 5th Sep 2007 AndrewTaylor Thread title (original '101% Off-Topic Kong Country') changed
12:16, 6th Sep 2007 AndrewTaylor Thread title (original 'The 573642891% Off-Topic Sudoku') changed
16:47, 11th Sep 2007 thomasp Thread title (original 'The Highly Factorisable 468% Off-Topic Thread') changed
20:37, 14th Sep 2007 AndrewTaylor Thread title (original 'The 31.830989π% Off-Topic Thread') changed
13:49, 15th Sep 2007 AndrewTaylor Thread title (original 'John McCain's 100% Off-Topic House Of Stubbornness') changed
23:05, 15th Sep 2007 AndrewTaylor Thread title (original 'As you know, for security reasons, the 100% Off Topic Thread's name changes daily.') changed
14:37, 16th Sep 2007 thomasp Thread title (original 'The 14.855% Of All Posts In Open Discussion Thread') changed
17:59, 16th Sep 2007 AndrewTaylor Thread title (original 'The 2.462% Of All Posts In ALL FORUMS Thread') changed
20:25, 17th Sep 2007 AndrewTaylor Thread title (original 'The 0.0013% Of All Posts ON THE INTERNET Thread') changed
17:16, 19th Sep 2007 thomasp Thread title (original 'The 0.00003% of EVERYTHING EVER Thread!') changed
23:44, 19th Sep 2007 AndrewTaylor Thread title (original 'The ∞% of NOTHING NEVER Thread!') changed
23:52, 20th Sep 2007 AndrewTaylor Thread title (original 'Save The Cheerleader, Save The 100% Off Topic Thread') changed
01:04, 22nd Sep 2007 AndrewTaylor Thread title (original 'BANG! And The 100% Off Topic Thread Is Gone!') changed
11:02, 23rd Sep 2007 thomasp Thread title (original 'BANG! Und Der 100% Off Topic Thread Ist Gone!') changed
16:23, 23rd Sep 2007 thomasp Thread title (original 'The 0% On Topic Thread') changed
21:37, 24th Sep 2007 AndrewTaylor Thread title (original 'The -100% Anti-Topic Thread') changed
20:23, 27th Sep 2007 AndrewTaylor Thread title (original 'The 30c Homoeopathic Preparation Of Topic. Thread.') changed
20:35, 2nd Oct 2007 AndrewTaylor Thread title (original 'The 95% Fat Free Thread (contains no topic)') changed
21:16, 2nd Oct 2007 thomasp Thread title (original 'The 100% Quit-Option Free Topic') changed
19:13, 3rd Oct 2007 thomasp Thread title (original 'The 100% Quit-Option Free Topic. FACT!') changed
19:14, 3rd Oct 2007 thomasp Thread title (original 'The 100% "Engineers. FACT!') changed
19:14, 3rd Oct 2007 thomasp Thread title (original 'The 100% Quit-Option. FACT!') changed
20:37, 3rd Oct 2007 AndrewTaylor Thread title (original 'The 100% Quit-Option Free topic. FACT!') changed
Continued in next post
Contd.
22:23, 3rd Oct 2007 thomasp Thread title (original 'The 63% Off-Topic Thread (damn quitters)') changed
10:01, 4th Oct 2007 thomasp Thread title (original 'The 60% Off-Topic Thread (damn quitters)') changed
16:55, 4th Oct 2007 thomasp Thread title (original 'The 58% Off-Topic Thread (damn quitters)') changed
18:53, 4th Oct 2007 thomasp Thread title (original 'The 56% Off-Topic Thread (damn quitters)') changed
10:16, 5th Oct 2007 thomasp Thread title (original 'The 54% Off-Topic Thread (damn quitters)') changed
11:24, 5th Oct 2007 thomasp Thread title (original 'The 51% Off-Topic Thread (damn quitters)') changed
15:39, 5th Oct 2007 thomasp Thread title (original 'The 49% Off-Topic Thread (damn quitters)') changed
11:05, 6th Oct 2007 thomasp Thread title (original 'The 45% Off-Topic Thread (damn quitters)') changed
21:34, 6th Oct 2007 thomasp Thread title (original 'The 42% Off-Topic Thread (damn quitters)') changed
22:17, 7th Oct 2007 thomasp Thread title (original 'The 39% Off-Topic Thread (damn quitters)') changed
08:27, 8th Oct 2007 thomasp Thread title (original 'The 33% Off-Topic Thread (damn quitters)') changed
16:18, 8th Oct 2007 thomasp Thread title (original 'The 30% Off-Topic Thread (damn quitters)') changed
22:43, 10th Oct 2007 thomasp Thread title (original 'The 27% Off-Topic Thread (damn quitters)') changed
16:31, 11th Oct 2007 thomasp Thread title (original 'The 20% Off-Topic Thread (damn quitters)') changed
08:19, 12th Oct 2007 thomasp Thread title (original 'The 15% Off-Topic Thread (these quitters are getting really annoying...)') changed
01:24, 13th Oct 2007 AndrewTaylor Thread title (original 'The 10% Off-Topic Thread (these quitters are getting really annoying...)') changed
20:28, 13th Oct 2007 AndrewTaylor Thread title (original 'Quakerworm's 0% Anything At All Thread') changed
18:17, 15th Oct 2007 AndrewTaylor Thread title (original 'I'm CJ, And I've Been A Winner On Beat The Nation, Fifteen To One, and 100% Off Topic') changed
17:57, 17th Oct 2007 AndrewTaylor Thread title (original 'How Does A 100% Off-topic Thread Look Like?') changed
00:05, 21st Oct 2007 AndrewTaylor Thread title (original 'The X100% Japan Off-Topic Thread') changed
21:02, 22nd Oct 2007 AndrewTaylor Thread title (original 'Kelster, your 100% off-topic thread is a harshly-coloured monstrosity.') changed
21:03, 22nd Oct 2007 AndrewTaylor Thread title (original 'The Twelve Twelths Off-Topic Thread That Refuses To Go Metric') changed
13:18, 25th Oct 2007 AndrewTaylor Thread title (original 'The Twelve Twelfths Off-Topic Thread That Refuses To Go Metric') changed
16:15, 28th Oct 2007 AndrewTaylor Thread title (original 'HackerMan's "Rockstar have said this thread is 6,000% off topic MINIMUM" Thread') changed
23:22, 29th Oct 2007 AndrewTaylor Thread title (original 'The 100% Off Topic Thread Mark I') changed
22:01, 4th Nov 2007 AndrewTaylor Thread title (original 'by the way thomasp you can probably un-sticky the 100% off-topic thread') changed
22:39, 7th Nov 2007 thomasp Thread title (original 'Dwarf Fortress: More 100% Off-Topic than MFAH's topic.') changed
11:32, 10th Nov 2007 thomasp Thread title (original 'I Gon Dun Made me a Fred: 100% Off topic Stupidity on the Forum') changed
23:51, 16th Nov 2007 AndrewTaylor Thread title (original 'Let's Play '100% Offtopic Thread' Again!') changed
13:22, 20th Nov 2007 AndrewTaylor Thread title (original 'Infraction For Paul.Power: 100% Off-Topic Posts') changed
12:58, 21st Nov 2007 AndrewTaylor Thread title (original 'The 0x64% Off Topic thread') changed
15:15, 23rd Nov 2007 AndrewTaylor Thread title (original 'Okay its 20% i won't create an off topic thread. And 80% i will.') changed
10:43, 26th Nov 2007 AndrewTaylor Thread title (original 'Super 100% Off Topic Thread Galaxy') changed
11:14, 29th Nov 2007 AndrewTaylor Thread title (original '100% Off Topic Thread Error. An Email Has Been Sent To The Administrator.') changed
11:14, 30th Nov 2007 AndrewTaylor Thread title (original 'The 100% Seizure-Inducing (And Also Off-Topic) Thread') changed
20:48, 12th Dec 2007 AndrewTaylor Thread title (original 'The 100% Off Topic Thread On Legs') changed
20:17, 16th Dec 2007 AndrewTaylor Thread title (original 'The 100% Off Topic Thread Will Draw You!') changed
10:24, 22nd Dec 2007 AndrewTaylor Thread title (original 'Merry 100% Off Topic Thread') changed
10:24, 22nd Dec 2007 AndrewTaylor Thread title (original 'Bah, 100% Off Topic Humbig!') changed
12:00, 25th Dec 2007 AndrewTaylor Thread title (original 'Bah, 100% Off Topic Humbug!') changed
12:16, 1st Jan 2008 AndrewTaylor Thread title (original 'The 3% Off Topic Wise Men') changed
22:18, 3rd Jan 2008 AndrewTaylor Thread title (original 'The 2008% Off Topic Thread') changed
18:10, 5th Jan 2008 AndrewTaylor Thread title (original 'Vader's 666% Off Topic Thread') changed
18:29, 8th Jan 2008 AndrewTaylor Thread title (original 'The 100% Pot Noodle Discussion Thread!') changed
18:29, 8th Jan 2008 AndrewTaylor Thread title (original 'The 182% Off Topic Thread (shown with results omitted)') changed
21:40, 11th Jan 2008 AndrewTaylor Thread title (original 'The 82% Off Topic Thread (shown with results omitted)') changed
13:12, 12th Jan 2008 AndrewTaylor Thread title (original 'Barack Obama's 38% Off-Topic Thread') changed
15:24, 13th Jan 2008 AndrewTaylor Thread title (original 'Intel's 99.99998475275646% Off-Topic Thread') changed
22:06, 18th Jan 2008 AndrewTaylor Thread title (original 'RealVG's 10/10 Off-Topic Thread') changed
18:52, 26th Jan 2008 AndrewTaylor Thread title (original 'Leisure Suit Larry's 69% Off-Topic Thread') changed
18:37, 30th Jan 2008 AndrewTaylor Thread title (original 'The Ill-Thought Out Intensifier Themed 110% Off-Topic Thread') changed
23:11, 1st Feb 2008 thomasp Thread title (original 'And Now, The 100% Off-Topic Intros Round') changed
21:30, 6th Feb 2008 AndrewTaylor Thread title (original 'And now for something completely 100% Off-topic') changed
22:06, 12th Feb 2008 AndrewTaylor Thread title (original '2001%: A Space Off-Topicity') changed
19:00, 15th Feb 2008 AndrewTaylor Thread title (original 'Horizon's In No Way Nonsensical W²/(M-N+1) Percent Off-Topic Thread') changed
22:44, 15th Feb 2008 AndrewTaylor Thread title (original 'The 100% Off-Topic Cake Is A Lie') changed
22:28, 24th Feb 2008 AndrewTaylor Thread title (original 'to teh dev's [100% Off-Topic Thread]') changed
08:42, 27th Feb 2008 thomasp Thread title (original 'The 100% Off Topic Thread Is Gay And It's Great!') changed
00:12, 3rd Mar 2008 AndrewTaylor Thread title (original 'The 5.3% Off Topic Earthquake - with aftershocks') changed
22:10, 5th Mar 2008 AndrewTaylor Thread title (original 'Poke The 100% Off-Topic Thread And Die') changed
19:17, 12th Mar 2008 thomasp Thread title (original 'Why Was The 100% Off Topic Thread Deleted?') changed
19:17, 12th Mar 2008 thomasp Thread title (original 'The "Pineapples shoud 100% not be kept off this topic" thread') changed
19:17, 12th Mar 2008 thomasp Thread title (original 'The "Pineapples should 100% not be kept off this topic" thread') changed
18:18, 14th Mar 2008 AndrewTaylor Thread title (original 'The "Pineapples should 100% be kept off this topic" thread') changed
13:20, 21st Mar 2008 AndrewTaylor Thread title (original 'St Patrick's 100% Off-Topic (By Volume) Thread') changed
22:47, 4th Apr 2008 AndrewTaylor Thread title (original 'To be honest, I'm not 100% Off-Topic myself. It's just whaaaaaa...aaaat.') changed
15:29, 12th Apr 2008 AndrewTaylor Thread title (original 'Oh, and That's a Bad 100% Off-Topic Thread...') changed
14:24, 19th Apr 2008 AndrewTaylor Thread title (original 'the... um... 100% changing thread title thread thing') changed
18:58, 19th Apr 2008 AndrewTaylor Thread title (original 'Arthur C Clarke's 100% Off-Topic World') changed
00:49, 2nd May 2008 AndrewTaylor Thread title (original 'Saying "It's 100% Off-Topic" Is Not An Excuse For Bad Posting') changed
12:59, 3rd May 2008 AndrewTaylor Thread title (original 'Clare Bennet's 12% Off- No, 24%, No, 57%, No, 92%, No, 100% Orff-Topic Thread') changed
23:00, 6th May 2008 AndrewTaylor Thread title (original 'Where Can I Download A 100% Off-Topic Save Game?') changed
23:00, 6th May 2008 AndrewTaylor Thread title (original 'FAO Akuryou: This is NOY the 100% Off-Topic Thread.') changed
01:20, 17th May 2008 AndrewTaylor Thread title (original 'FAO Akuryou: This is NOT the 100% Off-Topic Thread.') changed
01:17, 7th Jun 2008 AndrewTaylor Thread title (original 'If 100% Off-Topic Monkeys Had 100% Off-Topic Typewriters...') changed
20:36, 11th Jun 2008 AndrewTaylor Thread title (original 'Mark Corrigan's 85% Sure It's Off-Topic Thread') changed
22:51, 20th Jun 2008 AndrewTaylor Thread title (original 'I Can Haz 100% Off-Topic Thread') changed
15:42, 6th Jul 2008 thomasp Thread title (original 'Should unregistered users be allowed to view the 100% Off-Topic Thread?') changed
19:05, 18th Jul 2008 AndrewTaylor Thread title (original 'The 100% Rain-soaked standard British Summer Off Topic Thread') changed
19:05, 18th Jul 2008 AndrewTaylor Thread title (original 'The 100% Off-Topic Thread is classified. Only top ranking personnel allowed.') changed
22:52, 6th Aug 2008 AndrewTaylor Thread title (original 'The 100% Off-Topic Thread is classified. Only top ranking personnel allowed. And Paul') changed
11:49, 11th Aug 2008 AndrewTaylor Thread title (original '100% Off-Topic Nonsense. AKA, John McCain's Energy Policy. ... ... ... ZING!') changed
20:31, 1st Sep 2008 AndrewTaylor Thread title (original 'The 100.0% ± 4.3% Off-Topic Thread (p < 0.05)') changed
23:48, 14th Sep 2008 AndrewTaylor Thread title (original 'The 100TeV Off-Topic Hadron Collider') changed
21:07, 15th Sep 2008 AndrewTaylor Thread title (original 'I Can Haz 100% Off-Topic Tehrd?!') changed
22:25, 17th Sep 2008 AndrewTaylor Thread title (original '100%OffTopicThread.Com') changed
00:34, 24th Sep 2008 AndrewTaylor Thread title (original 'The (2^43,112,609 - 1)% Off-Topic Thread') changed
23:08, 24th Sep 2008 AndrewTaylor Thread title (original '100% Off-Topic things that people said about you before you were invited...') changed
23:51, 29th Sep 2008 AndrewTaylor Thread title (original 'John McCain's 100% Off-Topic Answer To Any Question About The Economy') changed
22:00, 3rd Oct 2008 AndrewTaylor Thread title (original 'The 700,000,000,000% Off-Topic Thread Bailout') changed
00:31, 8th Oct 2008 AndrewTaylor Thread title (original 'The Top 100% Off-Topic Games Of One Word') changed
**Current title: I'm Paul Varley, and I approve the 100% Off Topic Thread**
Squirminator2k
8 Oct 2008, 16:31
Can we just rename this thread "THREAD"?
The title's only just been changed. Plus it has to have some reference to 100% OT in it :p
Squirminator2k
8 Oct 2008, 16:34
Well you're no fun.
Squirminator2k
8 Oct 2008, 16:34
I have a sudden urge to make a "Taylor/Whateverthomaspslastnameis" campaign logo.
So I found this: http://www.filehippo.com/updatechecker
If you've got an incessant need to keep your software up to date like me, it's very handy.
Or you could get a good distro of linux with a large database of packages, such as Buntu...
Squirminator2k
8 Oct 2008, 18:09
Let's not have this discussion.
Paul.Power
8 Oct 2008, 18:24
Let's not have this discussion.
You came to the right thread.
So, USB numeric keypads. Handy for laptops if you want to play GMod or Dwarf Fortress or something.
You came to the right thread.
So, USB numeric keypads. Handy for laptops if you want to play GMod or Dwarf Fortress or something.
Yes. That sounds handy. I wish my laptop keyboard had a numeric pad, but it doesn't. However, I'm not sure if the USB keybpad benefits are worth it, I find having stuff on USB annoying. For every thing you plug into a laptop it's mobility is reduced.
worMatty
8 Oct 2008, 19:45
People who need to use an external numerical keypad will be keeping their laptop set up in one place for a decent length of time, won't they?
AndrewTaylor
8 Oct 2008, 21:02
I have a sudden urge to make a "Taylor/Whateverthomaspslastnameis" campaign logo.
It's not Palin.
It's not Palin.
Is it "Power"?
The secret child of Paul?
Paul.Power
8 Oct 2008, 21:55
I think Thomas told me what it was once, but he doesn't want it to become public knowledge.
In lieu of an answer (and because it's funnier), here, have this:
31920
For every thing you plug into a laptop it's mobility is reduced.
Unless it's wheels or wings.
Unless it's wheels or wings.
Or jet and rocket propulsion.
Or the Chronosphere.
All 183 thread topic title changes. Note that each entry is not what it changed to but what it changed from. I'm sure you'll figure it out :p
Those are so awesome.
I propose "100% Melamine-free Chinese Powdered Milk" after Paul has been elected.
I propose "100% Melamine-free Chinese Powdered Milk" after Paul has been elected.
You need to PM those suggestions to the mods, so you don't spoil the fun in advance. :-/
SomePerson
10 Oct 2008, 08:30
This makes my life! :D
http://www.youtube.com/watch?v=XAg5KjnAhuU
It's a guy with a Ukulele/piano/kazoo all in one.
Akuryou13
10 Oct 2008, 13:48
I don't know if that is more hilarious or pathetic :D
MtlAngelus
12 Oct 2008, 00:01
So just this week I have about enough money to actually buy a wacom cintiq, and the dollar suddenly goes stupidly expensive.
Here's a nice chart.
http://finance.yahoo.com/currency/convert?amt=1&from=USD&to=MXN&submit=Convert
So now it'll actually cost me a lot more than it should.
Maybe I should wait it out. :-/
Akuryou13
12 Oct 2008, 01:45
lol what the hell happened there?!
also, explain the cintiq to me. is it just a fancy monitor or is it an actual computer?
lol what the hell happened there?!
also, explain the cintiq to me. is it just a fancy monitor or is it an actual computer?
No it's just a fancy tablet monitor.
FutureWorm
12 Oct 2008, 02:59
lol what the hell happened there?!
recent global financial turmoil has, for some reason, caused the dollar to gain significantly on other global currencies
is this the 100% offtopic thread? :P
AndrewTaylor
12 Oct 2008, 16:10
recent global financial turmoil has, for some reason, caused the dollar to gain significantly on other global currencies
It might even approach its usual value...
Squirminator2k
14 Oct 2008, 22:04
Paul Varley was at PAX! And I can prove it!
http://farm4.static.flickr.com/3082/2810088497_5fbeb8a6b3.jpg
Third Cowboy on the far right, singing the Bad Horse refrain to Felicia Day.
MtlAngelus
14 Oct 2008, 22:40
Ah now I remember where I saw that gal. She was in a House episode.
Isn't she from Dr. Horrible's Sing-along Blog?
Squirminator2k
14 Oct 2008, 23:31
She is indeed! She's also remarkably cool to hang out with.
worMatty
14 Oct 2008, 23:59
What cowboy wears a bowler hat?
No, that isn't a banker joke.
SomePerson
15 Oct 2008, 05:04
My roommate showed me this cool open source fractal calculating program, XaoS (http://wmi.math.u-szeged.hu/xaos/doku.php)
That's some pretty freaking trippy stuff there. :eek:
FutureWorm
15 Oct 2008, 08:33
She is indeed! She's also remarkably cool to hang out with.
well aren't you just hobnobbing with the d-list celebrities
FutureWorm
15 Oct 2008, 09:04
i love getting new shoes
http://h.photos.cx/Photo14-626.jpg
but on another topic, what am i supposed to think about this
http://h.photos.cx/41Yb2yCdJKL._SS500_-e79.jpg
thomasp
16 Oct 2008, 20:43
Yanks will sue anybody or anything for anything: http://news.bbc.co.uk/1/hi/world/americas/7673591.stm
Paul.Power
16 Oct 2008, 22:29
Yanks will sue anybody or anything for anything: http://news.bbc.co.uk/1/hi/world/americas/7673591.stm
Brilliant. Major props to both Senator Chambers and the judge (as little sense as it makes to support both sides of the argument). Well, assuming they're both joking anyway. Still, as an atheist it's fun to watch from the side and make notes :p.
I wonder what would happen if someone tried to sue Father Christmas? After all, he has a known address (indeed, two known addresses: the North Pole and Lapland).
MtlAngelus
17 Oct 2008, 04:44
I just went trough all the troubles in the world to buy the Watchmen graphic novel. I know I've already read it (how? I'm sure you can put 2+2 together. :p). Why? Well, I think it's easier to re-read it when having a physical copy, and also because it's easier to get other people to read it. :D
I wonder what would happen if someone tried to sue Father Christmas? After all, he has a known address (indeed, two known addresses: the North Pole and Lapland).
I thought he had moved to the Coca Cola HQ in Atlanta, GA, USA many decades ago.
AndrewTaylor
17 Oct 2008, 19:31
Paul Varley was at PAX! And I can prove it!
http://farm4.static.flickr.com/3082/2810088497_5fbeb8a6b3.jpg
Third Cowboy on the far right, singing the Bad Horse refrain to Felicia Day.
I'm sure I've seen video of someone else Bad Horse Flashmobbing Felicia Day. I vote the next group do alternate lyrics.
These are my suggestion:
You'd think it would enrage her
When everywhere she goes
A group of random strangers
Dressed in cowboy clothes
Sneak up behind Felicia
And start to sing "Bad Horse"...
(It's a group song yet no-one tries
To learn the parts and harmonise...)
Pickleworm
17 Oct 2008, 22:31
i love getting new shoes
http://h.photos.cx/Photo14-626.jpg
http://h.photos.cx/20081017-qr3d3tihyyajctdmtkh87k942-522.jpg
[i]what it look like...
FutureWorm
18 Oct 2008, 17:12
http://h.photos.cx/20081017-qr3d3tihyyajctdmtkh87k942-522.jpg
[i]what it look like...
my shoes > your shoes
Paul Varley was at PAX! And I can prove it!
What a devilish-looking rapscallion!
Paul.Power
20 Oct 2008, 13:48
I love how I managed to fit the sentence "Admittedly "most vivid memories" is a relative term in regards to cupholders" into the "What browser do you use?" thread :p.
Akuryou13
20 Oct 2008, 15:02
I love how I managed to fit the sentence "Admittedly "most vivid memories" is a relative term in regards to cupholders" into the "What browser do you use?" thread :p.you truly are a master wordsmith. I bow to your expertise.
Akuryou13
22 Oct 2008, 16:05
ya know? I've heard people say jokingly that one day the most revolutionary advance in medical technology would be invented and it would first be released as a video game. well, I just got finished watching an episode of a fairly new show on Discovery called Prototype This! In that episode they designed and built a car that could register its driver's anger level and switch the car into neutral when they got too stressed/angry in order to prevent accidents through road rage situations. they did this through use of the new Emotiv Mind-Control Gaming Headset.
obviously the application they used it for was of relatively minor significance, but if this most basic level of the controller can be used to do something as advanced as that, I can't wait to see what's done with the technology in other fields.
Paul.Power
22 Oct 2008, 18:08
ya know? I've heard people say jokingly that one day the most revolutionary advance in medical technology would be invented and it would first be released as a video game. well, I just got finished watching an episode of a fairly new show on Discovery called Prototype This! In that episode they designed and built a car that could register its driver's anger level and switch the car into neutral when they got too stressed/angry in order to prevent accidents through road rage situationsI would not like to be driving along and the car suddenly went into neutral because I got angry.
It's bad enough when I do it accidentally while slipping from first to second.
SomePerson
22 Oct 2008, 18:58
If I'm angry and my car goes into neutral, that's just going to make me more frustrated, which will make it stay in neutral, etc. I don't feel like your car going into neutral is really going to have a sudden calming effect, or that it's really going to do anything positive.
I see what you mean in some regards about technology, but I dread to think how annoying "brain happiness scans" could get. It's not about how angry you are, it's more about how you control your anger. And if you had to pass a certain "happiness threshold" to board an airplane or that kind of thing, that would be terrible.
Pickleworm
22 Oct 2008, 19:52
my shoes > your shoes
http://h.photos.cx/20081022-1xm6jirin4ke4tqtjqt6u5hhuc-0e7.jpg
I usually wear these...w/e dude. And dont tell me there a thing wrong with rod lavers
Akuryou13
23 Oct 2008, 03:19
I would not like to be driving along and the car suddenly went into neutral because I got angry.
It's bad enough when I do it accidentally while slipping from first to second.I meant it more in terms of the technology available. the idea is a horrible one :p
their suggestion for the idea was to have the cars, in the future, pull off into a pit stop if the driver gets angry. granted, that idea isn't much better.
what impressed me was the idea that we have technology now to adapt situations and objects to your mood. or the ability to scan a person's brain waves in a portable device at all. I look forward to more advanced control of things through brain power once they evolve the technology a bit more. if nothing else, the idea intrigues me.
edit: http://forum.team17.co.uk/showthread.php?t=37492 awesome way to close the "continue the story!" thread, guys :D
Paul.Power
23 Oct 2008, 18:06
*randomly finds out through Wikipedia that Rhodri Morgan, the First Minister for Wales, is a supporter of the British Humanist Society, along with a whole bunch of other people (http://en.wikipedia.org/wiki/British_Humanist_Association#Distinguished_Support ers)* Awesome.
Star Worms
23 Oct 2008, 20:20
ya know? I've heard people say jokingly that one day the most revolutionary advance in medical technology would be invented and it would first be released as a video game. well, I just got finished watching an episode of a fairly new show on Discovery called Prototype This! In that episode they designed and built a car that could register its driver's anger level and switch the car into neutral when they got too stressed/angry in order to prevent accidents through road rage situations. they did this through use of the new Emotiv Mind-Control Gaming Headset.
obviously the application they used it for was of relatively minor significance, but if this most basic level of the controller can be used to do something as advanced as that, I can't wait to see what's done with the technology in other fields.So basically, don't get angry when in the outside lane on a motorway.
Ford are planning on introducing a parental control system to their cars where parents can set a maximum speed to stop their children driving fast.
What is this world coming to?
Ford are planning on introducing a parental control system to their cars where parents can set a maximum speed to stop their children driving fast.
How the heck do they think that this will that work?
Parents limit speed to 120kph, kiddie crashes the car with 70kph in a 50kph zone.
Parents limit speed to 50kph, kiddie gets crashed from behind by truck when entering the highway.
:rolleyes:
SupSuper
23 Oct 2008, 21:35
Parental control is incredibly paranoid these days. I've seen home laptops for kids that let their parents limit for how long they can use the computer / go online based on an amount of score gained from educational games included.
worMatty
23 Oct 2008, 23:15
Wow. Now is the time we start to automate looking after our kids, too.
Squirminator2k
23 Oct 2008, 23:22
It's been happening for years. It is for this reason that I absolutely detest the LeapFrog Learning Pad, a horrible little device that teaches your children how to read. I'm strongly of the opinion that a child should not have to walk into another room to tell their parents that they can read now. Parents should be more involved in the upbringing of their kids.
Honestly, if you didn't want to look after the child, why'd you have the bloody thing in the first place?
Akuryou13
24 Oct 2008, 01:32
It's been happening for years. It is for this reason that I absolutely detest the LeapFrog Learning Pad, a horrible little device that teaches your children how to read. I'm strongly of the opinion that a child should not have to walk into another room to tell their parents that they can read now. Parents should be more involved in the upbringing of their kids.
Honestly, if you didn't want to look after the child, why'd you have the bloody thing in the first place?lol, exactly. this is a HUGE problem we're having here in america if not everywhere else. parents aren't taking an active part in raising their child but rather using all these neat little toys to do it for them. children are growing into spoiled brats and parents aren't disciplining them as they should be because they're just too lazy to do so. it's bad when people either clap or get offended when someone disciplines their kids in public.....
FutureWorm
24 Oct 2008, 07:10
It's been happening for years. It is for this reason that I absolutely detest the LeapFrog Learning Pad, a horrible little device that teaches your children how to read. I'm strongly of the opinion that a child should not have to walk into another room to tell their parents that they can read now. Parents should be more involved in the upbringing of their kids.
Honestly, if you didn't want to look after the child, why'd you have the bloody thing in the first place?
quite right. although i taught myself to read so
Pickleworm
24 Oct 2008, 10:26
Am I supposed to love or hate google? Because Google Docs might be my most favorite thing ever
I don't see much point in google docs.
MrBunsy
24 Oct 2008, 11:58
Any computer with web access can get to your docs - very, very handy.
Just stick em on an FTP server. I have about 5 that people on the internet have offered me :p
I'm sure there's probably an app to synchronise a folder with a folder on an FTP server every hour and at shutdown.
MrBunsy
24 Oct 2008, 16:32
Then you've got to have an ftp client, which are rarely on random library computers.
Then you've got to have an ftp client, which are rarely on random library computers.
Every decent web browser has FTP support.
Besides, I wouldn't want to have Google, the multimillion dollar, data hoarding and web crawling company, to watch over my content.
Content you might want to publish in a scientific magazine or research data that are the base of your whole work.
BTW, I've signed a non-disclosure agreement at the company I'm working for, so I couldn't use applications like Google Docs anyway.
All the data has to stay at the in-house servers, with VPN connections for external access.
FutureWorm
24 Oct 2008, 23:16
Am I supposed to love or hate google? Because Google Docs might be my most favorite thing ever
'scoo !
AndrewTaylor
25 Oct 2008, 00:32
Every decent web browser has FTP support.
That's really not something you want to rely on, and your suggestion is overcomplicated and ugly.
SupSuper
25 Oct 2008, 01:28
I just stuff it all in my e-mail.
Pickleworm
25 Oct 2008, 02:23
Every decent web browser has FTP support.
Besides, I wouldn't want to have Google, the multimillion dollar, data hoarding and web crawling company, to watch over my content.
Content you might want to publish in a scientific magazine or research data that are the base of your whole work.
BTW, I've signed a non-disclosure agreement at the company I'm working for, so I couldn't use applications like Google Docs anyway.
All the data has to stay at the in-house servers, with VPN connections for external access.
Yes but I'm a stupid high school kid and I'm not writing anything groundbreaking here. And Google Docs is ultimately much more convenient and less headachey than using a browser's ftp interface to edit documents with whatever. I was basically asking just to figure out whether we regarded Google as an evil company that's going to steal all our information and brainwash us yet or not.
AndrewTaylor
25 Oct 2008, 02:40
I like Google. They do good things and most of it is free. I know I pay with information, but I don't care: relevant ads are good for me as well. Also, Google seem to be nice people, which is important to me for some reason. Companies like Microsoft, Sony, Nestle and so on always seem quite impersonal and it's easy to see them as the standard capitalist monsters, but Facebook, Google, innocent and suchlike feel more human and I tend to expect morals with that. Of course, you can do that cynically, but generally I think the people who would do that would be bad at it.
SupSuper
25 Oct 2008, 03:17
Good Old Games (http://www.gog.com/en/frontpage/) has gone into open beta, for those that missed out before.
MtlAngelus
25 Oct 2008, 06:19
So I went to see Max Payne. A lot of the story was changed, that makes me sad. :(
Star Worms
25 Oct 2008, 11:29
I like Google. They do good things and most of it is free. I know I pay with information, but I don't care: relevant ads are good for me as well. Also, Google seem to be nice people, which is important to me for some reason. Companies like Microsoft, Sony, Nestle and so on always seem quite impersonal and it's easy to see them as the standard capitalist monsters, but Facebook, Google, innocent and suchlike feel more human and I tend to expect morals with that. Of course, you can do that cynically, but generally I think the people who would do that would be bad at it.
I would agree about Google, but not Facebook since it was sold. All they've done is buy the popularity of Facebook. What have they actually done? 1. Made user-submitted applications. I like that. What did they do wrong? Then tons of people ended up with a bazillion application boxes on their profile. Their fault you may say. I think it's Facbook's for making it a default select. After realising their error they obviously decided they needed a way to get rid of all the boxes. And so the crappy new Facebook layout was born.
What I liked about Facebook when I joined was that everything was nice, clean and tidy. Not like MySpace where everyone had ugly designs and pieces of crap all over the place. It was a relief to be able to clearly read things. I liked ow Facebook had everything nice and organised. Now though, I'm not allowed to simply read posts on my wall, I have to click to read each post. And it makes no real sense to merge everything together into the mini-feed. It just doesn't work. Image is everything on the internet, and if Facebook aren't careful, I think people will start moving to another site.
Anyway, rant over. I like Google, but not Facebook.
worMatty
25 Oct 2008, 12:50
What I liked about Facebook when I joined was that everything was nice, clean and tidy. Not like MySpace where everyone had ugly designs and pieces of crap all over the place. It was a relief to be able to clearly read things. I liked ow Facebook had everything nice and organised. Now though, I'm not allowed to simply read posts on my wall, I have to click to read each post. And it makes no real sense to merge everything together into the mini-feed. It just doesn't work. Image is everything on the internet, and if Facebook aren't careful, I think people will start moving to another site.
I dislike clutter on pages, too, Andy. That's why I closed my MySpace account, and also because the place seemed more of a site to accommodate show-offs than a useful social networking app. Some of my Facebook friends do have application overload, and though I refrain from commenting on that, they know my thoughts on it and if they don't, they can probably glean that from looking at my profile. I'm a minimalist when it comes to web apps; I like simplicity but without sacrificing convenience, and I think Facebook achieves this very well.
It took me a little time to get used to the new design but like anything new and complicated, time is needed to adjust. I think the change in layout was necessary, due to what has developed and been added as the service has grown. I imagine it was a difficult task for the developers (drawing from my own minimal experience of trying to shoehorn things in to web pages). But now I know my way around it, I still find it comfortable, clean and fast.
If you prefer the old list style of wall posts, go to your profile, and while on the Wall tab choose 'Posts by others'. They will all be listed for you.
I don't think people will be moving from Facebook at all. Its core functionality remains exactly the same, and if you don't like what other people put on their profiles, you don't have to visit them. These days I receive far less stupid invitations to become a vampire or a drug lord, probably because eventually people realise I don't go for that kind of stuff. Thank Steve they created the 'ignore all' function.
I have a Facebook group to admin, too :-) The Maplin group, which holds 452 members currently. Otherwise I don't use the service a great deal for things like chatting, but my profile is always there for my friends. I couldn't do without it these days. In fact, it's the best way I've found to keep in touch with people. An email address or telephone number written down or saved in a phone's memory could be accidentally lost or deleted. "Do you have Facebook? Search for me," is now all it takes.
Google can have my information. Their email service is, without exaggeration, the best I have ever used, including POP and IMAP, and I am so glad my current ISP Be* do not supply one for as part of their packages, because I wouldn't have looked at Google Mail seriously. My only disappointment is that my address isn't really an @gmail.com one, it's @googlemail.com, but I can still receive mail to @gmail.com so that's the domain I publish my address with, and what I put in the reply-to field. Sadly, a decent mail client will still display the email as coming from me @googlemail, even though it constructs reply emails to the other.
AndrewTaylor
25 Oct 2008, 15:22
I like the new Facebook look, too. I literally can't understand what the perceived problem with it is. To be honest, I read wall posts in GMail, though, so maybe if other people use the site differently then the changes will be different to them.
SupSuper
25 Oct 2008, 16:05
Facebook is awesome because you can set the language as "English (Pirate)". :cool:
worMatty
25 Oct 2008, 23:19
For ten minutes, yes.
Speaking of Facebook, I used their Help system recently and submitted a request to add Chester as a regional network. I got an email saying they planned to include it as part of their next update! Hopefully other cities will be included. Presently I can only choose Manchester or Liverpool; Wrexham seems to have been removed.
So I went to see Max Payne. A lot of the story was changed, that makes me sad. :(
Why do you want to see a story you already know?
MtlAngelus
26 Oct 2008, 00:02
Why do you want to see a story you already know?
Why do you re-read a book you've already read?
Why do you watch a movie you've seen before, or a re-make of a movie you've seen before? Or replay a game you've played before? Re-listen a song you've listened to before?
It's a really stupid question to ask. :p
SupSuper
26 Oct 2008, 01:36
from: Gareth Manderson <mahamadi@kele.com.cn>
to: webmasters@dream17.co.uk
date: 25 de Outubro de 2008 22:55
subject: Recession Fears Stoke Global Market Woes
Markets in tailspin
Always good to know.
worMatty
26 Oct 2008, 12:41
Why do you re-read a book you've already read?
Why do you watch a movie you've seen before, or a re-make of a movie you've seen before? Or replay a game you've played before? Re-listen a song you've listened to before?
It's a really stupid question to ask. :p
On the other hand, why do we get bored of things we already know and like to see things that are different? Xinos has a point.
On the other hand, why do we get bored of things we already know and like to see things that are different?
Because those things were boring, shallow and easily predictable in the first place.
MtlAngelus
26 Oct 2008, 18:41
On the other hand, why do we get bored of things we already know and like to see things that are different? Xinos has a point.
I'm all in for new takes on stuff I already know(I loved the new take on the Joker on the Dark Knight), but not when they not only add nothing to the story, but actually take a lot away from it.
Pickleworm
26 Oct 2008, 22:46
Why do you want to see a story you already know?
*re-reads a story*
*doesn't get anything new from it, ever*
AndrewTaylor
26 Oct 2008, 22:58
On the other hand, why do we get bored of things we already know and like to see things that are different?
Nobody does that.
worMatty
26 Oct 2008, 23:21
Yes they do.
Pickleworm
26 Oct 2008, 23:52
Yes they do.
It's because those things sucked and lacked replay value anything that matters that you truly enjoy you will be able to enjoy with lasting value, which would you rather watch on tv for the rest of eternity, "meet the fockers" or "eraserhead"
AndrewTaylor
27 Oct 2008, 00:14
Yes they do.
I put it to you that Coldplay still exist. People like to see the same stuff they've seen forever, over and over forever, and those that don't are rare and precious.
On an unrelated note (http://www.apathysketchpad.com/blog/2008/10/27/somebody-is-going-to-get-fired/),
I never would have guessed Governor Sarah Palin had a style team. Her outfits are so hideous and her hair is quite unprofessional looking.
Paul.Power
27 Oct 2008, 00:47
I love rereading stuff I've already read. Sometimes I pick up new stuff, but mostly it's "oh, that was an awesome bit, I want to have it transferred from the printed page through my eyes into my brain again".
Paul.Power
27 Oct 2008, 18:38
Jim Davis on Garfield Minus Garfield (http://garfieldminusgarfield.net/):
“I think it’s an inspired thing to do,” Davis said. “I want to thank Dan for enabling me to see another side of Garfield. Some of the strips he chose were slappers: ‘Oh, I could have left that out.’ It would have been funnier.”
Hey, looks like he has got some soul left.
The specific press release (http://garfieldminusgarfield.net/day/2008/07/31/)
I gotta admit, amazon.com impresses me sometimes. Having spent 20 minutes in my turned-off car beaming Lordi to my radio and having the hell rocked out of me for the first time in a while, imagine my thrill when I found an email a few minutes later saying "Hey, we have exactly what you want -- Lordi's new album Deadache, and we have it for $14!" It wasn't even one of those "Hi there, you bought this, so you might like these" ones they periodically send out, this was a specific "We know you want this" one. Bull'seye. Maybe not so technically impressive since I've bought every other Lordi album off them, but still. Their strategy must be a damn efficient one. Show people what they want via buying-history-sensitive recommendations, and then make the purchasing process extremely fast and easy.
Edit: They're so good at the buying-history-based recommending, in fact, that after I bought a specific USB WiFi Connector, Monster Hunter Freedom 2 started coming up in my recommendations. Most of you probably know that this is something I already have, and in fact, is the very reason I bought the connector.
http://forum.team17.co.uk/showthread.php?t=37261
Akuryou13
30 Oct 2008, 14:53
http://forum.team17.co.uk/showthread.php?t=37261yes. already in the stupidity thread :p
yes. already in the stupidity thread http://forum.team17.co.uk/images/newsmilies/tongue.gif
Whoops, wrong thread.
I think I might give Kubuntu-KDE4 another chance.
Star Worms
2 Nov 2008, 16:54
Go Hamilton!
That is all.
Awesome telly tonight - nail-biting finish to the F1 (don't think a championship's ever been decided so late in the season!) and Top Gear messing about with artics Strictly Come Dancing :D
Paul.Power
2 Nov 2008, 23:00
Awesome telly tonight - nail-biting finish to the F1 (don't think a championship's ever been decided so late in the season!)Well, apart from last time.
Although in terms of "decided by one guy overtaking another on the final lap in the final race", then yes, probably the latest.
Star Worms
2 Nov 2008, 23:07
Well, apart from last time.
Although in terms of "decided by one guy overtaking another on the final lap in the final race", then yes, probably the latest.And on one of the very last corners too.
I thought he'd lost it (as I'm sure anyone watching did).
I like our "Spawn Car" key. In a very short time the level can be filled with buggys that just drive around aimlessly.
http://img381.imageshack.us/img381/8903/carspawnve4.th.jpg (http://img381.imageshack.us/my.php?image=carspawnve4.jpg)http://img381.imageshack.us/images/thpix.gif (http://g.imageshack.us/thpix.php)
I am amazed at the fact that polygons don't seem to make much of a difference in terms of framerate. Each buggy in that picture is about 18000 polygons. What makes it slow down is that each buggy has physics properties and they are colliding into each other.
AndrewTaylor
3 Nov 2008, 15:16
In case any of you haven't been paying attention, I've rigged my laptop so I can play music using a Wii Guitar Hero controller.
http://www.realvg.org/display.php?type=articles&id=259
I love how fast writing code is in C#. It makes this kind of tinkering much more accessible.
I stopped reading at the word "C#".
Star Worms
4 Nov 2008, 01:52
Go Obama!
That is all.
AndrewTaylor
4 Nov 2008, 03:30
I stopped reading at the word "C#".
That's rarely wise in anything about music.
Especially if you're playing Beethoven's 14th Piano Sonata.
New Zealand election is coming up this Saturday. It's pretty much certain that we're getting a different prime minister simply because most people are tired of the current political party & leader.
That's rarely wise in anything about music.
LOL!
Well, in music, you generally tend to see it written on a stave, not actually written "C#". Then it looks something more like #d but the d looking more like a note and having a line going through it. (or not, if it's in a space)
SupSuper
9 Nov 2008, 01:14
Really cheap games! Audiosurf (http://store.steampowered.com/app/12900/) and Eets (http://store.steampowered.com/app/6100/) for just $2.49 each!
Decided to look up that Face Your Manga (www.faceyourmanga.com) thingy I'd been seeing products of around the Internet here and there...
32052
Not too bad.
I printscreened the result rather than give them my email address, by the way. I looked at the privacy statement, but it was in Spanish (despite "lang=eng" in the url) and apparently they want to send you a jpeg anyway. Why bother with that?
Paul.Power
9 Nov 2008, 10:01
Oh right, that. I wondered where they were all coming from.
dammit, why are all the eyebrows bar one set angry ones.
dammit, why isn't there a dark brown.
Makes me look like a child...
http://img90.imageshack.us/img90/8712/bonzmangaeu0.png
Paul.Power
9 Nov 2008, 12:25
Oh hey, not far to post 14444.
Akuryou13
9 Nov 2008, 14:13
Oh hey, not far to post 14444.is this an important number?
reasonably accurate:
http://img136.imageshack.us/img136/719/faceyourmangauq9.jpg
Here's me.
http://img65.imageshack.us/img65/846/paranoidandroid1hotmailnx7.jpg (http://imageshack.us)
Can't be arsed to get flash working :p
Paul.Power
9 Nov 2008, 15:07
is this an important number?
No, but it looks nice.
MtlAngelus
9 Nov 2008, 15:29
I printscreened the result rather than give them my email address, by the way. I looked at the privacy statement, but it was in Spanish (despite "lang=eng" in the url) and apparently they want to send you a jpeg anyway. Why bother with that?
That's Italian, actually. :p
Anyway:
:cool:
http://img239.imageshack.us/img239/6443/mangafacehb3.jpg
My hair is not that blond. But it was more accurate than any of the sites browns. Oh well.
FutureWorm
9 Nov 2008, 22:01
I printscreened the result rather than give them my email address, by the way. I looked at the privacy statement, but it was in Spanish (despite "lang=eng" in the url) and apparently they want to send you a jpeg anyway. Why bother with that?
that's italian dude
e: ah **** i read thread good
Akuryou13
10 Nov 2008, 00:42
My hair is not that blond. But it was more accurate than any of the sites browns. Oh well.yeah I had that problem too. the shade I went with looks kinda sickening but it's the only thing that isn't bright blonde or dark brown.
Pickleworm
10 Nov 2008, 03:19
i spent like an hour+ drawing a picture
it only saved one layer
this is the layer it saved:
http://h.photos.cx/anime-fbd.gif
woot
That's Italian, actually. :pHeh, whoops. I only glanced at it. :p
MonkeyforaHead
10 Nov 2008, 03:43
e - i - e - i - o
Not really, though. My hair's actually really long and mostly kept behind my ears these days, but I couldn't find anything appropriate; technically I am planning a haircut anyway. Also, I can only wish I could grow a beard at least remotely resembling that. :eek:
GoDxWyvern
10 Nov 2008, 12:04
Actually pretty accurate, though I wish I had a Space Invaders shirt.
Edit: Too bad these are too big for a new fad, eh. :P
Akuryou13
10 Nov 2008, 14:04
Edit: Too bad these are too big for a new fad, eh. :Phardly. it would take all of 5 seconds for me or someone with a similar program to shrink them.
worMatty
10 Nov 2008, 18:22
Is it possible to not look evil or smug in that anime avatar app?
Paul.Power
10 Nov 2008, 18:39
Is it possible to not look evil or smug in that anime avatar app?
There is one set of eyebrows that does it.
However, they look stupid.
SupSuper
10 Nov 2008, 19:41
Edit: Too bad these are too big for a new fad, eh. :PThis fad has long hit the rest of the internet though so it wouldn't be as shocking.
Star Worms
11 Nov 2008, 22:33
As always I either have to have bright orange hair or brown hair...
Akuryou13
11 Nov 2008, 22:34
As always I either have to have bright orange hair or brown hair...I love how video games, avatar sites, etc all think that the only way to be a red head is to have bright carrot-colored hair. it amuses me and it never fails to be true.
I love how video games, avatar sites, etc all think that the only way to be a red head is to have bright carrot-colored hair. it amuses me and it never fails to be true.
It's probably because they all just copy each other and just think about ratings. The sites are still popular and they all get away with it. So why bother?
Pickleworm
12 Nov 2008, 01:31
It's probably because they all just copy each other and just think about ratings. The sites are still popular and they all get away with it. So why bother?
f*cking hair color conspiracy... down with games
I love how video games, avatar sites, etc all think that the only way to be a red head is to have bright carrot-colored hair. it amuses me and it never fails to be true.And, ironically, I'm probably the only one here whose Face Your Manga result actually has a reasonably close hair color. :p
Akuryou13
12 Nov 2008, 11:05
And, ironically, I'm probably the only one here whose Face Your Manga result actually has a reasonably close hair color. :pmine's pretty close if not for the sickly shade of it.
Akuryou13
12 Nov 2008, 16:04
I enjoyed this FAR too much not to share:
http://www.somethingpositive.net/arch/sp11102008.gif
AndrewTaylor
12 Nov 2008, 19:17
I love how video games, avatar sites, etc all think that the only way to be a red head is to have bright carrot-colored hair. it amuses me and it never fails to be true.
Miis don't even get that. Blond, brown or black are your options.
SupSuper
12 Nov 2008, 21:32
Or none.
worMatty
12 Nov 2008, 22:22
Good find, Nathan.
Star Worms
12 Nov 2008, 23:07
It reminds me of the difference between babies and bowling balls.
It reminds me of the difference between babies and bowling balls.
What's that?
[/complete lack of knowledge of jokes]
AndrewTaylor
12 Nov 2008, 23:31
If you throw a baby in the gutter it doesn't come back.
Star Worms
12 Nov 2008, 23:50
What's that?
[/complete lack of knowledge of jokes]
You can't unload a truckload of bowling balls with a pitchfork.
AndrewTaylor
13 Nov 2008, 00:47
You can only get one finger in a baby.
Akuryou13
13 Nov 2008, 00:57
You can only get one finger in a baby. *awards andrew the "Most Inappropriate Statement of the Year" award :eek:
Akuryou13
13 Nov 2008, 01:41
I think I found myself a new gaming mouse!
15 buttons = awesome in a can
http://www.steelseries.com/int/products/partners
FutureWorm
13 Nov 2008, 04:36
you can only get one finger in a baby.
nnnnnnnnnnice
Star Worms
13 Nov 2008, 09:24
How do you get a baby in a jar?
Using a blender.
How do you get it out again?
Nachos.
thomasp
13 Nov 2008, 12:57
Thank you for that Star Worms, I had just eaten :p
MrBunsy
13 Nov 2008, 14:03
There are far worse :p
On a different note, these arrived in the post this morning!
http://www.lukewallin.co.uk/images/bunnies.jpg
MtlAngelus
13 Nov 2008, 14:09
I think I found myself a new gaming mouse!
15 buttons = awesome in a can
http://www.steelseries.com/int/products/partners
Overkill? :p
Akuryou13
13 Nov 2008, 14:26
On a different note, these arrived in the post this morning!did you file a formal complaint?
Overkill? :pwell I've got 9 buttons on my mouse, but only 4 of them are usable. so having 15 buttons would equal about 8 usable buttons. basically, just what my mouse has plus the D pad. I think that sounds very nice, personally.
:mad::mad: MOAR BUTTONZ!!! :mad::mad:
MrBunsy
13 Nov 2008, 16:10
did you file a formal complaint?
You hurt their feelings :(
FutureWorm
13 Nov 2008, 19:05
There are far worse :p
On a different note, these arrived in the post this morning!
awwwwwwwwwwwww
worMatty
13 Nov 2008, 20:08
The style of that mouse resembles the house robots from the UK Robot Wars TV show.
philby4000
14 Nov 2008, 03:12
The style of that mouse resembles the house robots from the UK Robot Wars TV show.
Holy crap, it's Sir Killalot.
Akuryou13
14 Nov 2008, 03:34
Holy crap, it's Sir Killalot.the knight with the spear thing? I don't see the resemblance.
Akuryou13
15 Nov 2008, 01:55
holy crap. this guy's a friggin GENIUS! it makes PERFECT SENSE!
http://www.youtube.com/watch?v=Tn2UCqL5qyo
I challenge any of you to dispute the theory! in fact, I challenge any of you to understand the theory enough to even consider disputing it!
edit: also, this thread from The Escapist is a great read: http://www.escapistmagazine.com/forums/read/18.71500?page=1
I got scared and closed the tab after the first sentance :p
Paul.Power
15 Nov 2008, 13:51
That "stupid things people say" thread is like the proverbial car crash.
Saying that, I have just looked away, so...
Akuryou13
15 Nov 2008, 14:24
I got scared and closed the tab after the first sentance :pbut then you've missed comic gems like:
"Russia's Czar will never stop invading random countries, like he has for the last ten years, until he allows a revote for Cuba's next president who will hopefully sell the nuclear weapons Russian gave them and has been forcing Cuba to threaten America with. When theat happens, China will have the chance they have been looking for to invade from the north and take Russia once and for all."
also, I seem to have linked to page 4. I'll go fix that.
Star Worms
15 Nov 2008, 14:38
Anyone know of a decent program that can convert excel tables into html?
And before you say, Excel can't do it properly - I have tried. It alters the widths of the columns and overlaps the text.
AndrewTaylor
15 Nov 2008, 15:12
Export to csv and then find-replace works pretty well.
The Left 4 Dead demo is out and is awesome!
I was playing it all night with some friends last night. I was quite impressed by it. Very solid gameplay and fantastic animations. I just love seeing all those zombies tumble when they are shot running :D
MtlAngelus
15 Nov 2008, 20:24
The tank is awesome. And deadly. And awesome.
Unfortunately my teammates usually run away from it and leave me alone facing it. :P
Star Worms
15 Nov 2008, 22:21
Export to csv and then find-replace works pretty well.I found a similar tip online, which said that Dreamweaver can import table data (after converting to csv).
I also read during my internet travels that in court Microsoft admitted to deliberately doing this to make it only work with Internet Explorer.
Pickleworm
16 Nov 2008, 02:59
I need to figure out where these two curves intersect:
2x^2+3y^2=5
y^2=x^3
I've already found the answer by just plugging it into my calculator, but I need to solve it algebraically in order to receive full credit. I know that I'd find out the point(s) of intersection if I just solve this system of equations, but when I substitute I get
3x^3+2x^2-5=0
And unless I'm mistaken, that doesn't factor. There's a flake of a memory of how to solve for the roots of the equation without factoring, but it was convoluted and was pretty much guess and check. Is there anyone who knows how to solve this? It seems like it should be really simple as the answers are just (1,1) and (1,-1) but maybe my mind isn't working in the right way at the moment
Akuryou13
16 Nov 2008, 03:00
*cues paul*
Paul.Power
16 Nov 2008, 11:08
I need to figure out where these two curves intersect:
2x^2+3y^2=5
y^2=x^3
I've already found the answer by just plugging it into my calculator, but I need to solve it algebraically in order to receive full credit. I know that I'd find out the point(s) of intersection if I just solve this system of equations, but when I substitute I get
3x^3+2x^2-5=0
And unless I'm mistaken, that doesn't factor. There's a flake of a memory of how to solve for the roots of the equation without factoring, but it was convoluted and was pretty much guess and check. Is there anyone who knows how to solve this? It seems like it should be really simple as the answers are just (1,1) and (1,-1) but maybe my mind isn't working in the right way at the momentWell, if the answers are that simple then it has to factor. You know from your calculator that x = 1 is in the solutions, so "try" long dividing 3x^3+2x^2+0x-5 by (x-1). I'll bet the other two roots are complex, but that's not the issue as long as you show that they're complex and therefore not of interest. And once you have x, y is a walk in the park.
Star Worms
16 Nov 2008, 12:18
I need to figure out where these two curves intersect:
2x^2+3y^2=5
y^2=x^3
I've already found the answer by just plugging it into my calculator, but I need to solve it algebraically in order to receive full credit. I know that I'd find out the point(s) of intersection if I just solve this system of equations, but when I substitute I get
3x^3+2x^2-5=0
And unless I'm mistaken, that doesn't factor. There's a flake of a memory of how to solve for the roots of the equation without factoring, but it was convoluted and was pretty much guess and check. Is there anyone who knows how to solve this? It seems like it should be really simple as the answers are just (1,1) and (1,-1) but maybe my mind isn't working in the right way at the momentHow about this?
2x^2+3y^2=5
y^2=x^3
2x^2+3y^2 -5 =0
3y^2 - 3x^3 = 0
2x^2+3y^2 -5 = 3y^2 - 3x^3
2x^2 -5 = - 3x^3
2x^2 + 3x^3 - 5 = 0
x^2(2+3x) - 5 = 0
so x = 1
Then plug that into one of the original formulas
y^2=x^3
y^2=1
y= +1 or -1
And just to double check:
2x^2+3y^2=5
2 + 3y^2 = 5
3y^2=3
y^2=1
y= +1 or -1
ie (1,1) and (1,-1)
vBulletin® v3.8.6, Copyright ©2000-2013, Jelsoft Enterprises Ltd.